Review




Structured Review

Amaxa nucleofector ii device
Nucleofector Ii Device, supplied by Amaxa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nucleofector+ii+device/device+ii+nucleofector/us12533338-60-25-19
Average 86 stars, based on 1 article reviews
nucleofector ii device - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

other:

Article Title: Reverse engineering neuron-type-specific and type-orthogonal splicing-regulatory networks using diverse cellular transcriptomes
Article Snippet: Nucleofector II device (program A-24) , Amaxa/Lonza , N/A.

Article Title: G-protein coupled receptor kinase-2 regulates the migration of chronic lymphocytic leukaemia cells to sphingosine-1 phosphate in vitro and their trafficking in vivo.
Article Snippet: Complexes were then electroporated into 6 × 106 leukemic cells resuspended in 95 μL of mouse B-cell nucleofector solution (Lonza, Switzerland) using the Z-001 program in the Amaxa Nucleofector II device.

Article Title: Designing Macrocyclic Kinase Inhibitors Using Macrocycle Scaffold Hopping with Reinforced Learning (Macro-Hop).
Article Snippet: Macrocycles have gained significant attention in drug discovery, with over 70 macrocyclic compounds currently in clinical use.. Despite this progress, the effective methods for designing macrocycles remain elusive.. In this study, we present MacroHop, a reinforced learning framework designed to rapidly and comprehensively explore the macrocycle chemical space.

Article Title: G-protein coupled receptor kinase-2 regulates the migration of chronic lymphocytic leukaemia cells to sphingosine-1 phosphate in vitro and their trafficking in vivo
Article Snippet: Complexes were then electroporated into 6 × 10 6 leukemic cells resuspended in 95 μL of mouse B-cell nucleofector solution (Lonza, Switzerland) using the Z-001 program in the Amaxa Nucleofector II device.

shRNA:

Article Title: The HRAS-binding C2 domain of PLCη2 suppresses tumor-like synoviocytes and experimental arthritis in rheumatoid arthritis.
Article Snippet: The DNA and shRNA vectors were transfected separately into cells using the Human Dermal Fibroblast Nucleofector Kit (Lonza) according to the manufacturer’s protocol. .. In brief, 5 × 105 cells were resuspended in 100 μl of nucleofector solution containing DNA or shRNA plasmids and electroporated with the U-23 program on an Amaxa Nucleofector II device. ..

Transfection:

Article Title: Enhanced gene delivery to natural killer cells, hematopoietic stem cells and macrophages
Article Snippet: .. Human primary macrophages, CD34+ HSCs and NK92 cell line were transfected with Cas9-2A-GFP and gRNA encoding plasmids using respective Amaxa kits and cell-specific program using Nucleofector II device (VAPA-1003 for CD34+HSCs, VAPA-1008 for Macrophages cells, and VVPA-1005 for NK92 cells) according to manufacturer's instructions except in half of the groups, we have added 1 uM iX into the manufacturer's transfection reagent. .. The following commercially available guide RNAs from Origene Technologies were tested against Beta 2 Microglobulin: GATGTCTCGCTCCGTGGCCT (Seq.

Article Title: Discovery of a novel flagellar filament system underpinning Leishmania adhesion to surfaces.
Article Snippet: All the transfections were performed using the X-001 programme on the Amaxa Nucleofector II device and successful transfectants selected, after 6 hours, using blasticidin (5 μg/ml), puromycin (20 μg/ml) or G-418 (20 μg/ml) (Melford Laboratories). .. All the transfections were performed using the X-001 programme on the Amaxa Nucleofector II device and successful transfectants selected, after 6 hours, using blasticidin (5 μg/ml), puromycin (20 μg/ml) or G-418 (20 μg/ml) (Melford Laboratories). .. Cumulative cell growth was measured daily by counting the number of cells using the Beckman Coulter Counter.

Transformation Assay:

Article Title: Supporting Information Raman Chemical Imaging of Chromate Reduction Sites in a Single Bacterium Using Intracellularly Grown Gold Nanoislands
Article Snippet: .. Transformation was carried out using the Nucleofector II device (Amaxa, Inc., Koeln, Germany) with bacterial setting AG. ..



Similar Products

86
Amaxa nucleofector ii device
Nucleofector Ii Device, supplied by Amaxa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nucleofector+ii+device/device+ii+nucleofector/us12533338-60-25-19
Average 86 stars, based on 1 article reviews
nucleofector ii device - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Amaxa amaxa nucleofector ii device
Amaxa Nucleofector Ii Device, supplied by Amaxa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nucleofector+ii+device/device+ii+nucleofector/bio_rxiv__64898__2026__01__26__701660-112-36-36
Average 86 stars, based on 1 article reviews
amaxa nucleofector ii device - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Amaxa cell line nucleofector ii device
Cell Line Nucleofector Ii Device, supplied by Amaxa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nucleofector+ii+device/electroporation/bio_rxiv__64898__2025__12__13__694110-112-13-12
Average 86 stars, based on 1 article reviews
cell line nucleofector ii device - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
Lonza nucleofector ii device
Nucleofector Ii Device, supplied by Lonza, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nucleofector+ii+device/nucleofector+ii+device/pm40590555-427-21-25
Average 90 stars, based on 1 article reviews
nucleofector ii device - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results